StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Writing a protocol for genomic DNA extraction and PCR - Lab Report Example

Cite this document
Summary
10 μM stocks of Lambda primers, PC01: Forward-5’, GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5’-GGTTATCGAAATCAGCCACAGCGCC-3’’, template: bacteriophage lambda DNA (0.3 μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER94.2% of users find it useful
Writing a protocol for genomic DNA extraction and PCR
Read Text Preview

Extract of sample "Writing a protocol for genomic DNA extraction and PCR"

Download file to see previous pages

blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol . the sampling of the genomic DNA was used as templates for the PCR amplification with specific T .cruzi Mdna primers . Tcz1 and TC z2 and the KDNA primers s35 and s36 . the amplification reaction was run with 200ng templates DNA UNDER the subsequent conditions.0.2 Mm of each primer , 2.5 U Taq DNA Polymerase , 0.2 mM dNTP and 2 mM Mg Cl2 in a 25 ml final volume .

the triplicate amplification reaction were performed using the recommendations temperatures for Ndna ( 950C for five minutes , 30 cycles of 950 C for 30 s , 620C for 1 min nd 72 0C for 1 min and final extension at 72 o C for 5 min ) . The amplicons were resolved in the 1.3 % agarose gel The tumor tissue average RFU 0.254 corresponds to 406.25 standard and controls tissue average RFU 0.197corresponds to 275 standards. The curve is gently rises in a direct proportional manner to huge figures.

The scale of the graph presents 1 cm representing 125 ng/ul in y-axis while the 1 cm representing the 0.1 in x-axis (Maria & Frank , 10). 22. It is important to remove the supernatant then dry the pellet at the prevailing room temperature. Normally, the DNA do not attach or stick as expected on the walls of the tube following 70% ethanol wash. Caution and extreme should be maintained while to bid avoid any aspirating the pellet In conclusion, the protocol for DNA extraction and the PCR based typically on the main methods takes subsequent steps.

In the process of extraction large quantities of the DNA may be necessitate heating briefly at 65oC) for the suspension. The resulting large great molecular weight may undergo several days for proper

...Download file to see next pages Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Writing a protocol for genomic DNA extraction and PCR Lab Report”, n.d.)
Retrieved from https://studentshare.org/biology/1685168-writing-a-protocol-for-genomic-dna-extraction-and-pcr
(Writing a Protocol for Genomic DNA Extraction and PCR Lab Report)
https://studentshare.org/biology/1685168-writing-a-protocol-for-genomic-dna-extraction-and-pcr.
“Writing a Protocol for Genomic DNA Extraction and PCR Lab Report”, n.d. https://studentshare.org/biology/1685168-writing-a-protocol-for-genomic-dna-extraction-and-pcr.
  • Cited: 0 times

CHECK THESE SAMPLES OF Writing a protocol for genomic DNA extraction and PCR

DNA Extraction and Purification

After purification, the DNA isolates underwent polymerase chain reaction (pcr) using sexing primers 2250F and 2718R to replicate the sequence for sex determination.... Agarose gel electrophoresis of the pcr products were compared with that of known male and female samples to identify the sex of the chicken from which the samples were obtained.... Qiagen DNeasy Blood and Tissue extraction Kit was used for extraction.... The human genome project had been successful in sequencing the dna of humans (Venter et al....
5 Pages (1250 words) Lab Report

Extraction of plasmid DNA and set up of polymerase chain Reaction (PCR)

Due to the vast amount of processes pcr products can undergo, the technique has been the staple for laboratory diagnosis of diseases, bacteria and virus identification, crime scene investigations, and others.... As can be seen, pcr follows and precedes many other molecular processes.... After measuring the amount of DNA extracted, it was then prepared for pcr.... It basically amplifies a particular gene by conducting an in vitro dna replication....
5 Pages (1250 words) Coursework

Effect of Ocean acidification upon ability to genetically adapt in Nereis species

The aims of this project are to examine whether Nereid worms under low pH conditions show differences in the expression of genes and physiological metabolites (or proteins), and secondly how this environmental pressure might affect the animals ability to maintain functional… Therefore the project aims to determine if the worms obtained from natural CO2 vents are different from those living under controlled conditions, in terms of behaviour and physiology....
4 Pages (1000 words) Essay

Is human genome editing inevitable

The main reason for this technique to receive universal acclaim is that, unlike the previous methods, it is possible for scientists to insert, modify, or delete dna with unprecedented precision, increased efficiency, specificity, and more flexibility.... “The method, known by the acronym Crispr-Cas9, co-opts the natural immune system with which bacteria remember the dna of the viruses that attacks them so they are ready the next time those same invaders appear”....
5 Pages (1250 words) Essay

Extraction of Bacterial Chromosomal DNA

In the following essay “extraction of Bacterial Chromosomal DNA,” the author analyzes the bacterial cells burst, which opens at the initial point in the protocol when the barriers like cytoplasmic membrane and cell wall are disrupted by the enzyme lysozyme.... D260/OD280 ratio is used as an estimate of dna purity with a ratio between 1.... Aromatic amino acids present in proteins absorb at 280 nm which is present in the dna sample will contribute to the total absorbance....
7 Pages (1750 words) Essay

DNA Extraction and PCR of Bird DNA for Sex Identification

The "dna extraction and pcr of Bird DNA for Sex Identification" paper aims to extract the DNA from the muscle, blood, and feather of Gallus gallus and to estimate the concentration of the DNA from the three samples and amplify the CHD1 gene using PCR.... hellip; dna is the basic component of genes.... The variation in the dna composition and structure provides variation between the species and within the species.... dna sequence varies among the sexually dimorphic species females and males....
9 Pages (2250 words) Lab Report

Comparative Genomics

The sub-cloned samples were loaded in the 96 wells of the pcr plate and the original primers for the first screening used (Ciccarelli, and Miklods, 2009).... The pcr products were cloned, sequenced, and named depending on the organ of origin which was majorly the heart (cardiac)....
18 Pages (4500 words) Essay

DNA Extraction and Polymerase Chain Reaction of Bird DNA for Sex Identification

The paper "dna extraction and Polymerase Chain Reaction of Bird DNA for Sex Identification" determines the sex of individual species using different samples of DNA from blood, muscle, and feather of Gallus gallus.... nbsp; The use of PCR in the genetic sex identification of birds is ideal since it requires just a small sample, like a blood drop or a feather for dna extraction, minimizing individual bird's trauma.... Also, the yields of genomic dna decrease if the material samples are stored at -20°C without earlier treatment....
9 Pages (2250 words) Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us